Citation Context

...jor cytokine leading to the Th2 phenotype of the unpolarized Th cells. IL-4 actssthrough STAT6, and results in the Th2 phenotype and production of cytokines IL-4,sIL-13, IL-5, IL-9, IL-6, and IL-10. (=-=Hou et al., 1994-=-; Schindler et al., 1994; Seder andsPaul 1994) All the factors that contribute to the T helper cell differentiation are notsyet fully known, and the process is complex and several factors are known to...

Citation Context

...ions of the whole genome in a single experiment.sThe main disadvantage of the technology is its limited resolution being 10-20 Mbsfor deletions and 1 Mb for amplifi cations (Kallioniemi et al., 1994; =-=Bentz et al., 1998-=-,sForozan et al., 1997). The sensitivity for deletions can be improved to 3 Mb by using standard reference intervals, based on a series of normal samples (Kirchoff et al.,s1999). The length of amplifi...

Citation Context

...nome in a single experiment.sThe main disadvantage of the technology is its limited resolution being 10-20 Mbsfor deletions and 1 Mb for amplifi cations (Kallioniemi et al., 1994; Bentz et al., 1998,s=-=Forozan et al., 1997-=-). The sensitivity for deletions can be improved to 3 Mb by using standard reference intervals, based on a series of normal samples (Kirchoff et al.,s1999). The length of amplifi ed sequences that can...

Citation Context

...s of 13q,s17p, and 19, as well as 18 gain, which were present in fewer samples. The changesscommon to both CTCL and lung cancer were loss of 10q, 13q and 17p, and gains ofs7 and 8q (Coe et al., 2006; =-=Garnis et al., 2006-=-). Additionally, in CTCL-associated lungs46 cancer, some aberrations frequent in primary / reference lung cancer, were rare, if anys(detected in maximum one of the fi ve cases), especially 4q loss, 8p...

Citation Context

...d decreased 40% or more compared to its matching normal and decrease ofs21–39% of one allele relative to the other allele (in tumor tissue compared to matching normal tissue) is termed putative LOH. (=-=Canzian et al., 1996-=-). Table 6. Microsatellite markers used for NAV3 LOH analysis Marker Distance from NAV3 1) 5' - F primer - 3' 2) 5' - R primer - 3' D12S1684 1.0 Mb 1) CCTGCATGCCTCAGTTATGA 2) AACAAGCCATACCAGTCAGG D12S...

Citation Context

...l course and the disease progresses slowly. The estimated 5-year survival is 88% (Willemze et al., 2005). In advanced stages progression tosa CD30+ or CD30- large cell T-cell lymphoma may be present (=-=Cerroni et al., 1992-=-).sThe treatment is based on the stage (IA-IVB) of the disease. Aggressive therapy doessnot improve the prognosis or remission time. Skin-directed therapy usually leads tosremissions in the early stag...

Citation Context

... observed in both SS and MF PBMCssamples. S100P has a role in cell cycle progression and differentiation, and its upregulation has been found in various malignancies (Guerreiro Da Silva et al., 2000;s=-=Diederichs et al., 2004-=-; Sato et al., 2004; Hammacher et al., 2005). Because an expression bias for S100P was found in mycosis fungoides blood samples also, S100Psmay have a role in the early oncogenesis of CTCL. In additio...

Citation Context

...00P has a role in cell cycle progression and differentiation, and its upregulation has been found in various malignancies (Guerreiro Da Silva et al., 2000;sDiederichs et al., 2004; Sato et al., 2004; =-=Hammacher et al., 2005-=-). Because an expression bias for S100P was found in mycosis fungoides blood samples also, S100Psmay have a role in the early oncogenesis of CTCL. In addition, membrane-boundsLIR9 (215838_at) was over...

Citation Context

...gression to the leukaemic phase. This kind of a skewing is likely tosinfl uence the progressive immune dysregulation in CTCL and would thus provide asgrowth advantage for the malignant cell clone(s) (=-=Cosmi et al., 2004-=-). 5.2.3 Histogenesis of SPTL This study clarifi ed the classifi cation of cutaneous T-cell lymphomas. When the studyswas begun, subcutaneous panniculitis-like T-cell lymphomas were classifi ed amongs...

Citation Context

... is known to augment antitumor responsess(Cairns et al., 2001), and VAV3, like the other two VAV proteins, functions specifi callysin signaling pathways that trigger natural killer cell cytotoxicity (=-=Cella et al., 2004-=-).sKIR3DL2 (CD158K), a member of the killer cell immunoglobulin-like receptors, hassbeen suggested previously as a phenotypic marker for Sezary cells (PoszepczynskaGuigne et al., 2004) and has been fo...

Citation Context

...eration insthe skin. Autocrine IL-2, keratinocyte-derived IL-7, and APC-derived IL-15 are thesmost important growth factors promoting growth and survival of CTCL cells in vitros(Dalloul et al., 1992; =-=Döbbeling et al., 1998-=-). In later stages of CTCL, tumor cells maysbecome independent of these exogenous signals, e.g. by autocrine production of IL15 or by interactions via STAT (signal transducers and activators of transc...

Citation Context

...4). Contradictory, in this study the KIR3DL2 gene was downregulated insSezary syndrome samples. The discrepant observations of KIR3DL2 may be due tosthe considerable polymorphism of the KIR3DL2 gene (=-=Dohring et al., 1996-=-; Gardinerset al., 2001), or may refl ect the fact that only about half of the expanded T-cell clonessexpress CD158K and that CD158K expression is heterogeneous even within the malignant clones (Orton...

Citation Context

...ss of CD7 and CD26 (Vonderheid etsal., 2002; Willemze et al., 2005). The tumor cells are usually CD3+, CD4+, CD8-,sCD45RO+, CD30-, and mature Th2 memory cells (Vowels et al., 1992, Saed et al.,s1994; =-=Dummer et al., 1996-=-; Willemze et al., 2005). The prognosis in SS is poor, 5-yearssurvival being only 24% (Table 1). No curative therapy exists, but therapy recommendations include extracorporeal photopheresis either alo...

Citation Context

...affi nity IL-2R is expressed on ca. 50% of CTCL cells (Jones et al., 2004). Consequently, IL-2-targeted therapy has beensused for CTCL, most recently with a fusion protein denileukin diftitox (ONTAK; =-=Duvic et al., 1998-=-). Interestingly, the retinoid X receptor retinoid, bexarotene, a new therapeutic agent for mycosis fungoides (Duvic et al., 2000), upregulates both the α andsβ subunits of IL-2R. This, in turn, enhan...

Citation Context

...ne rearrangement analysis in unspecifi cs(Lukowsky et al., 2000; Sawabe et al., 2000) Further staging of MF is achieved by criteria proposed by North American MFsCooperative Group (Bunn et al., 1979; =-=Girardi et al., 2004-=-) recently revised by the International Society for Cutaneous Lymphomas (ISCL) and the cutaneous lymphomastask force of the EORTC (Olsen et al., 2007). MF is divided into four stages based onsskin, no...

Citation Context

...patientsswill suffer from a relapse. MF confi ned to skin is treated with photo(chemo)therapy:sUVB irradiation and PUVA, whereas combination chemotherapy is recommendedsfor systemic CTCL (stage IV). (=-=Dummer et al., 2003-=-; Whittaker et al., 2003; Trautingerset al., 2006)s1.2.1.2 Sezary syndrome (SS) Sezary syndrome (SS) is the leukaemic form of CTCL, where malignant T lymphocytesscirculate in the blood (Sezary et al.,...

Citation Context

...et al., 2004), the epigenetic gene silencing is speculated tosbe important in CTCL. In CTCL, promoter hypermethylation of genes encoding CDKN2A (Navas et al., 2000 and 2002; Scarisbrick et al., 2002, =-=Gallardo et al., 2004-=-), CDKN2B (Scarisbrick et al., 2002; Gallardo et al., 2004), MLH1 (Scarisbrick et al., 2003),sMGMT (Gallardo et al., 2004); BCL7A, PTPRG, TP73, and THBS4 (van Doorn et al.,s2005) has been reported, an...

Citation Context

...ls forming the primary tumor,snamely the cancer stem cells, which apart from being capable of self-renewal andsproliferation, also contribute to drug resistance and express typical stem cell markers (=-=Harris, 2004-=-; Dean et al., 2005; Polyak and Hahn, 2006). Cancer stem cells aresresponsible for initiating and sustaining tumor growth but are predicted to be refractory to current therapies which are designed to ...

Citation Context

... profi le of SS was confi rmed, but reports on MF showedsnonconsistent fi ndings with cytokine profi le favouring Th1 or Th2 polarization or nospolarization (Vowels et al., 1994; Dummer et al., 1996; =-=Harwix et al., 2000-=-). Besidesscytokine profi ling, also transcription factor level characteristics of CTCL have beensrevealed. Overexpression of GATA-3 and underexpression of STAT4 have been reported in Sezary syndrome ...

Citation Context

...entsde-differentation. Still another possibility is that bone marrow –derived CD34+ stemscells migrate to sites of tissue damage, where they become tissue-specifi c stem cellss(Passegue et al., 2003; =-=Borue et al., 2004-=-; Bjerkvig et al., 2005; Polyak and Hahn, 2006).sThere is experimental evidence supporting all these pathways, and it may be, that insdifferent tumour types, different pathways operate (Polyak and Hah...

Citation Context

...so far, although there are preliminarysreports of the initial malignant transformation to occur in bone marrow in a lowgrade cutaneous lymphoma, namely lymphomatoid papulosis (Gniadecki et al., 2003;s=-=Gniadecki, 2004-=-). It has been speculated that bone marrow –derived stem cells wouldsmigrate to the site of chronic skin infl ammation (like Parapsoriasis en plaques), oftenspreceding CTCL, and then either fuse with ...

Citation Context

...f CTCL, tumor cells maysbecome independent of these exogenous signals, e.g. by autocrine production of IL15 or by interactions via STAT (signal transducers and activators of transcription)smolecules (=-=Asadullah et al., 2000-=-; Qin et al., 1999, 2001). Disturbances in STAT signalling pathways have been observed in CTCL, e.g. constitutive STAT3 activation (Zhangset al., 1996), loss of STAT1 and STAT4 protein expression (Tra...

Citation Context

... 12 (4/9), in which the majority of the abnormalities were structural (Batista etsal., 2006). Moreover, recurrent breakpoints were observed in 1p32-p36, 6q22-q25,s17p11.2-p13, 10q23-q26, and 19p13.3 (=-=Batista et al., 2006-=-), regions often showingsDNA copy number losses in CGH studies (see 1.2.2.2; Karenko et al., 1999; Mao et al.,s2002; Fischer et al., 2004).sCross-species colour banding (Rx-FISH, Müller et al., 1997, ...

Citation Context

...illemze et al., 2005).s17 Clinically MF presents classically with the evolution of skin lesions from patches tosplaques and tumors mainly affecting trunk and other sun-protected areas (Alibert,s1806; =-=Bazin, 1852-=-; Figure 1A). The diagnosis of MF is diffi cult, since it often resembles eczema or mild psoriasis in its earliest stages. Often long-lasting observation ofsthe clinical picture together with multiple...

Citation Context

...mab), IL2R (Ontak), or CD4 molecules (zanolimumab). The usage of antibodybased therapy requires the malignant cells to express the certain membrane antigen.sMonoclonal antibodies are easy to prepare (=-=David et al., 1990-=-; Nikolova et al., 2001),sand thus suitable therapy means targeted against membrane proteins. In the genesexpression analysis (Study II), upregulated genes included MS4A4A and LIR9, whichswould become...

Citation Context

...rming bands. Espinet and coworkers used this technology in addition to thesconventional cytogenetics, and revealed aberrations in chromosomes 10, 1, 6, 8, 9, 11,sand 17 to be frequent in SS patients (=-=Espinet et al., 2004-=-). Still another novel technology, COBRA-FISH (Tanke et al., 1999), which is basedson the simultaneous use of combinatorial (binary) labelling and ratio labelling, hassrecently been used in CTCL resea...