Citation Context

...on of the pMR6-8 construct, all nisin-inducible FnBPA constructs have been described previously [17]. The pMR6-8 construct was made as described previously using standard molecular biology techniques =-=[17,33]-=-. Briefly, the enitre R6-8 fnbA variant was amplified from pFnBPR6-8 using primers containing NcoI and XhoI sites (AAACCATGGAGGAGGTATTATAGTGAAAAACAATCTTAGG) (AAACTCGAGCTAACTTTATCTCTCAGTTCGTTATC) and l...

Citation Context

...nterests exist. * E-mail: ae248@bath.ac.uk Introduction Staphylococcus aureus is a bacterium responsible for a wide range of superficial and invasive infections ranging in severity from mild to fatal =-=[1]-=-. In addition to causing severe morbidity and mortality in the healthcare environment, S. aureus is a growing problem in the community, causing serious infections in otherwise healthy people [2,3]. Tr...

Citation Context

...g problem in the community, causing serious infections in otherwise healthy people [2,3]. Treatment of S. aureus infections is often complicated by the high prevalence of antibiotic resistant strains =-=[4,5]-=-. Despite the ability of this organism to cause serious illness, S. aureus is primarily a commensal organism, residing within the nares and on the skin of 20–60% of the population either permanently o...

Citation Context

...Cloning host New England Biolabs BL21 Recombinant peptide expression host pGEX-6P-2 Expresses GST-tagged FnBR9,10 peptide This study Staphylococcus aureus DU5883 fnbA- fnbp- isogenic mutant of 8325.4 =-=[52]-=- DU5883 (pFnBA4) (referred to here as pFnBPR1–11) fnbp - strain complemented with the plasmid pFnBA4 expressing full-length FnBPA: FnBPR1–11 pFnBPR0 Expresses FnBPA variant containing no Fn-binding re...

Citation Context

...8,21]. FnBPs are multifunctional proteins, comprised of distinct regions with variable binding activity. The N-terminal domain binds both fibrinogen and elastin and is implicated in biofilm formation =-=[22,23]-=-. This region is followed by 11 (FnBPA) or 10 (FnBPB) non-identical fibronectin-binding repeats (FnBRs), with either high or low-affinity for fibronectin [24]. These multiple PLoS ONE | www.plosone.or...

Citation Context

...at FnBPA alone is sufficient for invasion since heterologous expression on the surface of otherwise non-invasive Lactococcus lactis or Staphylococcus carnosus confers the ability to invade host cells =-=[19]-=-. The indirect interaction of FnBPA with a5b1 integrins leads to cell signalling events, actin rearrangement and internalization of the bacterium via a mechanism that is entirely dependent on host-cel...

Citation Context

...fatal [1]. In addition to causing severe morbidity and mortality in the healthcare environment, S. aureus is a growing problem in the community, causing serious infections in otherwise healthy people =-=[2,3]-=-. Treatment of S. aureus infections is often complicated by the high prevalence of antibiotic resistant strains [4,5]. Despite the ability of this organism to cause serious illness, S. aureus is prima...

Citation Context

...ability of this organism to cause serious illness, S. aureus is primarily a commensal organism, residing within the nares and on the skin of 20–60% of the population either permanently or transiently =-=[6]-=-. Colonisation of the skin can lead to a number of persistent or recurring infections including, folliculitis, scalded skin syndrome, impetigo, colonisation of indwelling medical devices and wound inf...

Citation Context

...ct interaction of FnBPA with a5b1 integrins leads to cell signalling events, actin rearrangement and internalization of the bacterium via a mechanism that is entirely dependent on host-cell processes =-=[11,18,21]-=-. FnBPs are multifunctional proteins, comprised of distinct regions with variable binding activity. The N-terminal domain binds both fibrinogen and elastin and is implicated in biofilm formation [22,2...

Citation Context

...g problem in the community, causing serious infections in otherwise healthy people [2,3]. Treatment of S. aureus infections is often complicated by the high prevalence of antibiotic resistant strains =-=[4,5]-=-. Despite the ability of this organism to cause serious illness, S. aureus is primarily a commensal organism, residing within the nares and on the skin of 20–60% of the population either permanently o...

Citation Context

...sation of the skin can lead to a number of persistent or recurring infections including, folliculitis, scalded skin syndrome, impetigo, colonisation of indwelling medical devices and wound infections =-=[1,7,8]-=-. Although originally considered an extracellular pathogen, there is both in vitro and in vivo evidence that S. aureus invades host cells. Although the role of invasion in colonisation and infection i...

Citation Context

...his is a relatively rare event. It is more likely that the frequent interactions that occur between S. aureus and keratinocytes, involved in colonisation and infection of both nasal and skin surfaces =-=[12,13,32]-=-, are responsible for selection of FnBPA function. We therefore investigated the role of the FnBR-region in the adhesion to, and invasion of, keratinocytes. Methods Bacterial strains and growth condit...

Citation Context

...ing cell signalling processes, actin rearrangement and bacterial internalisation [27–29]. We have previously shown that this region is essential for triggering bacterial invasion of endothelial cells =-=[17,30]-=-. In addition to its role in adhesion, invasion and biofilm formation, the high prevalence of fnb genes amongst S. aureus strains suggest that FnBPs might be important for colonisation; analysis of a ...

Citation Context

...sation of the skin can lead to a number of persistent or recurring infections including, folliculitis, scalded skin syndrome, impetigo, colonisation of indwelling medical devices and wound infections =-=[1,7,8]-=-. Although originally considered an extracellular pathogen, there is both in vitro and in vivo evidence that S. aureus invades host cells. Although the role of invasion in colonisation and infection i...

Citation Context

...re is evidence that S. aureus is able to dramatically alter its phenotype (to the small colony variant phenotype) to enhance survival within host cells, which is associated with persistent infections =-=[14,15]-=-. The primary mechanism by which S. aureus enters host cells is well characterised; staphylococcal fibronectin binding proteins (FnBPs) interact with cell surface a5b1 integrins via a fibronectin brid...

Citation Context

...rogen), with calcium adjusted to 2.8 mM and supplemented with FBS (10%) and L-glutamine (2 mM) at 37uC and 5% CO2, conditions that support differentiation, keratinization and tight-junction formation =-=[38]-=-. Cells were cultured in T75 flasks to approximately 95% confluency, liberated with trypsin-EDTA, resuspended in culture medium and added to 24-well plates containing thermanox glass coverslips [30]. ...

Citation Context

...integrins to trigger invasion, the cellular mechanisms involved can vary significantly. For example, Streptococcus pyogenes can invade via both caveolae and membrane ruffling depending on the invasin =-=[39,40]-=-. To examine whether the difference in efficiency of invasion of keratinocytes when compared to endothelial cells is due to the bacteria utilizing a different cellular process, we measured the interna...

Citation Context

...re is evidence that S. aureus is able to dramatically alter its phenotype (to the small colony variant phenotype) to enhance survival within host cells, which is associated with persistent infections =-=[14,15]-=-. The primary mechanism by which S. aureus enters host cells is well characterised; staphylococcal fibronectin binding proteins (FnBPs) interact with cell surface a5b1 integrins via a fibronectin brid...

Citation Context

...ing cell signalling processes, actin rearrangement and bacterial internalisation [27–29]. We have previously shown that this region is essential for triggering bacterial invasion of endothelial cells =-=[17,30]-=-. In addition to its role in adhesion, invasion and biofilm formation, the high prevalence of fnb genes amongst S. aureus strains suggest that FnBPs might be important for colonisation; analysis of a ...

Citation Context

...ct interaction of FnBPA with a5b1 integrins leads to cell signalling events, actin rearrangement and internalization of the bacterium via a mechanism that is entirely dependent on host-cell processes =-=[11,18,21]-=-. FnBPs are multifunctional proteins, comprised of distinct regions with variable binding activity. The N-terminal domain binds both fibrinogen and elastin and is implicated in biofilm formation [22,2...

Citation Context

...s observed recently for a Fn-binding protein from Streptococcus pyogenes [48]. It is also possible that delayed entry of S. aureus into keratinocytes is desirable for the bacterium. A previous report =-=[49]-=- indicated that S. aureus delays uptake into endothelial cells in order to have sufficient time to prepare for intracellular life via up-regulation of e.g. toxin genes. It is possible that S. aureus e...

Citation Context

...ole-cell protein extracts. This revealed that a5b1 integrin expression levels were significantly higher in endothelial cells than keratinocytes (Fig. 7). This is consistent with studies of human skin =-=[41]-=-, and may explain the differences in invasion levels between the two cells types. PLoS ONE | www.plosone.org 5 April 2011 | Volume 6 | Issue 4 | e18899S. aureus Keratinocyte Invasion Figure 3. S. aur...

Citation Context

...ng Fn-binding repeats 7 & 8: FnBPR7,8 pFnBPR6–8 Expresses FnBPA variant containing Fn-binding repeats 6–8: FnBPR6–8 Lactococcus lactis L. lactis NZ9800 nisA defective isogenic mutant of NZ9700 (fnb-) =-=[53]-=- pMFnBPR1–11 Nisin controlled expression of FnBPA containing repeats 1–11: FnBPR1–11 [17] pMFnBPR1 Nisin controlled expression of FnBPA containing repeat 1: FnBPR1 pMFnBPR1,10,11 Nisin controlled expr...

Citation Context

...his is a relatively rare event. It is more likely that the frequent interactions that occur between S. aureus and keratinocytes, involved in colonisation and infection of both nasal and skin surfaces =-=[12,13,32]-=-, are responsible for selection of FnBPA function. We therefore investigated the role of the FnBR-region in the adhesion to, and invasion of, keratinocytes. Methods Bacterial strains and growth condit...

Citation Context

...and is implicated in biofilm formation [22,23]. This region is followed by 11 (FnBPA) or 10 (FnBPB) non-identical fibronectin-binding repeats (FnBRs), with either high or low-affinity for fibronectin =-=[24]-=-. These multiple PLoS ONE | www.plosone.org 1 April 2011 | Volume 6 | Issue 4 | e18899S. aureus Keratinocyte Invasion repeats enable a single FnBPA molecule to bind multiple fibronectin molecules [25...

Citation Context

...gst S. aureus strains suggest that FnBPs might be important for colonisation; analysis of a panel of 163 clinical isolates revealed that 22% encoded just fnbA, 1% just fnbB and 77% encoded both genes =-=[31]-=-. We recently investigated how the composition of the FnBR region of FnBPA affected the invasion of endothelial cells and virulence in a murine bacteremia model [17]. This study demonstrated that a si...

Citation Context

...ensin 3 reaches levels sufficient to kill S. aureus [42,43]. Cellular invasion is apparently not necessary to trigger these responses but internalised bacteria cause necrotic and apoptotic cell death =-=[37]-=-. Interestingly, S. aureus adhesion to endothelial cells was equal to that of keratinocytes after 15 minutes, but was significantly greater after 90 minutes. This may reflect a decrease in keratinocyt...

Citation Context

...his is a relatively rare event. It is more likely that the frequent interactions that occur between S. aureus and keratinocytes, involved in colonisation and infection of both nasal and skin surfaces =-=[12,13,32]-=-, are responsible for selection of FnBPA function. We therefore investigated the role of the FnBR-region in the adhesion to, and invasion of, keratinocytes. Methods Bacterial strains and growth condit...

Citation Context

...sence of multiple FnBRs within FnBPA may increase the efficiency of Fn binding through cooperative binding to arrays of FnBRs as observed recently for a Fn-binding protein from Streptococcus pyogenes =-=[48]-=-. It is also possible that delayed entry of S. aureus into keratinocytes is desirable for the bacterium. A previous report [49] indicated that S. aureus delays uptake into endothelial cells in order t...

Citation Context

.... Strains and plasmids used in this study. Species/strain/plasmid Relevant characteristics Source/Reference E. coli (pMSP7517) Nisin-inducible vector containing the prgB gene of Enterococcus faecalis =-=[51]-=- K12 ER2925 Cloning host New England Biolabs BL21 Recombinant peptide expression host pGEX-6P-2 Expresses GST-tagged FnBR9,10 peptide This study Staphylococcus aureus DU5883 fnbA- fnbp- isogenic mutan...

Citation Context

... FnBPs. The poor penetration of many antibiotics into cells means that intracellular S. aureus could represent a reservoir for persistent infection [13,14]. Our data, in keeping with previous reports =-=[18,30]-=-, strongly suggest that FnBR peptides are highly effective at reducing S. aureus invasion and might form a novel prophylactic approach to reducing carriage and/or the development of chronic infections...

Citation Context

...8,21]. FnBPs are multifunctional proteins, comprised of distinct regions with variable binding activity. The N-terminal domain binds both fibrinogen and elastin and is implicated in biofilm formation =-=[22,23]-=-. This region is followed by 11 (FnBPA) or 10 (FnBPB) non-identical fibronectin-binding repeats (FnBRs), with either high or low-affinity for fibronectin [24]. These multiple PLoS ONE | www.plosone.or...

Citation Context

...integrins to trigger invasion, the cellular mechanisms involved can vary significantly. For example, Streptococcus pyogenes can invade via both caveolae and membrane ruffling depending on the invasin =-=[39,40]-=-. To examine whether the difference in efficiency of invasion of keratinocytes when compared to endothelial cells is due to the bacteria utilizing a different cellular process, we measured the interna...

Citation Context

....pone.0018899.g006 keratinocytes results in inflammatory cytokine release and stimulates secretion of several antimicrobial peptides, of which b-defensin 3 reaches levels sufficient to kill S. aureus =-=[42,43]-=-. Cellular invasion is apparently not necessary to trigger these responses but internalised bacteria cause necrotic and apoptotic cell death [37]. Interestingly, S. aureus adhesion to endothelial cell...

Citation Context

....pone.0018899.g006 keratinocytes results in inflammatory cytokine release and stimulates secretion of several antimicrobial peptides, of which b-defensin 3 reaches levels sufficient to kill S. aureus =-=[42,43]-=-. Cellular invasion is apparently not necessary to trigger these responses but internalised bacteria cause necrotic and apoptotic cell death [37]. Interestingly, S. aureus adhesion to endothelial cell...

Citation Context

...stein does not inhibit all the targets of PP2. Indeed, this phenomenon has been observed previously in studies of invasion mediated by fibronectin-binding protein invasins of S. pyogenes. Wang et al. =-=[50]-=- showed that invasion of epithelial cells by L. lactis expressing M-protein could be inhibited by PP2 but not by genistein. Conversely, invasion by L. lactis expressing the invasin SfbI was inhibited ...