"... In PAGE 7: ...35 miR-34 3R:5926677 85F UGGCAGUGUGGUUAGCUGGUUG + + Verte- brate/ worm 477 upstream of Fmr1 2 miR clus- ter; expres- sion verified; [45] 50 19.27 miR-263a 2L:11942273 33B aAUGGCACUGGAAGAAUUCACg + + Verte- 4764 down- Expression 34] Table1 (Continued) List of Drosophila miRNAs and additional unverified candidates supported by third-species conservation Genome Biology 2003, 4:R42 brate stream of CG16964... In PAGE 8: ...35 3R:121090 82A AAAUUGACUCUAGUAGGGAGUCC + + 533 down- stream of CG9780 NT 14 22.63 X:1545630 2B UGCAGGUUUCGUCGACAACGA + - 732 NT Table1 (Continued) List of Drosophila miRNAs and additional unverified candidates supported by third-species conservation Genome Biology 2003, 4:R42 upstream of ... In PAGE 9: ... Most miRNAs are located in intragenic regions, and there is an apparent bias for intronic miRNAs to be located on the transcribed strand. Table1 (Continued) List of Drosophila miRNAs and additional unverified candidates supported by third-species conservation Genome Biology 2003, 4:R42 loops and bulged nucleotides was further penalized. The size of the hairpin loop was not specifically evaluated as it appears to be variable in known pre-miRNAs; however it was returns one to six alternate structures, each containing one to four helical arms; thus, the structure containing the highest-... In PAGE 10: ... The top three mosquito hits were then folded and scored as before. However, as a large fraction of known fly miRNAs lack mosquito counterparts ( Table1 ), we decided to rank the candidates solely on their average Dm/Dp score. miR-125 and miR-2c received exceptionally low scores in this analysis, while miR-10 was absent because it was not located in an alignable contig in the first available assembly of D.... In PAGE 10: ... Only about one-third of the highest-scoring conserved stem- loops passed these filters (with an even greater fraction of lower-scoring candidates failing these filters), leaving behind around 200 candidates from the initial top 600. Of the reference set, 18/24 (75%) reside in the first 124 candidates, demonstrating that the overall procedure robustly selected for genuine miRNAs (Figure 4, Table1 ). A second measure of the utility of assessing patterns of nucleotide divergence is their ability to select against self-complementary repeats.... In PAGE 11: ... Selected hybridizations that illus- trate the different temporal and quantitative profiles are shown in Figure 5 and the collected northern data are sum- marized in Table 2. We also note that these experimentally verified miRNAs vary tremendously in abundance, with sev- miR-137 and miR-219, Table1 ) may be present at even lower levels. This suggests that their identification by sequencing miRNA cDNA libraries would have been unlikely.... In PAGE 11: ... Two of the former class were low-scoring candi- dates that were nonetheless conserved in Anopheles (miR- 287 and miR-288), indicating that third-species conservation is in our hands a very strong indicator of a candidate gene apos;s validity. Table1 lists bona fide Drosophila miRNAs that scored in the top 208, grouped as members of the reference set followed by newly identified miRNAs that fulfill accepted criteria for miRNA biogenesis (that is, ones whose expression was confirmed here by northern blot and/or are homologous to miRNAs cloned in other species); each subset is rank- ordered by miRseeker score. The high-scoring, third-species- Figure 4 Efficient selection of genuine miRNAs by miRseeker.... ..."

"... In PAGE 4: ... So this also provides for the scalable coding of the har- monic signals. Table2 shows the results of applying lin- ear spectral interpolation in a low bit rate scalable coding framework. The flute signal has seven notes and signifi- cant spectral variations.... In PAGE 4: ... The trumpet signal has several notes and has both slow and rapid variations in the pitch and spectral values. In Table2 , CA is the ratio of number of selected spectra to the total spectra, C9BPC6,ex- pressed in percentage. BUC4 stands for the base layer and BXC4 stands for enhancement layer.... ..."

"... In PAGE 8: ...xtensions. All numbers were generated using the JavaNCSS tool [11]. .......... 60 Table8 . Number of Lines of Code added or modified when porting legacy applications to ISO-WSP.... In PAGE 80: ...67 Table8 presents the number of lines added or modified when porting two applications, the aforementioned Payment Processor service and our port of the RUBiS benchmark [18]. We can see that we have to add or modify few tens of lines of code, which amounts to a small fraction of the application.... ..."

"... In PAGE 6: ...1 dB. For such conditions, bitrates have been estimated for the scalable coder (whole scalable coder), nonscalable coder and simulcast coding ( Table2 and Fig. 3).... ..."

"... In PAGE 11: ... link in the abstract switch. Direction is a one-byte unsigned integer taking the value in Table 6. VPI and VCI are two-byte unsigned integers. Valid Code takes a value defined in Table7 . The Valid code tells the child process that Table 5: MP or Sink/Source OP Code NCMO_OPType Description NCMO_OP_NULL No operation.... ..."

"... In PAGE 11: ... link in the abstract switch. Direction is a one-byte unsigned integer taking the value in Table 6. VPI and VCI are two-byte unsigned integers. Valid Code takes a value defined in Table7 . The Valid code tells the child process that Table 5: MP or Sink/Source OP Code NCMO_OPType Description NCMO_OP_NULL No operation.... ..."

"... In PAGE 9: ... We evaluated the refactoring tool on a number of Java applications of up to 53 KLOC that we migrated from Vector to ArrayList, from Hashtable to HashMap, and from Enumeration to Iterator. Table1 states the essential char- acteristics for each benchmark program. From left to right, columns of the table indicate: (i) the benchmark name, (ii) the number of lines of source code (in thousands), (iii) the number of classes, (iv) the legacy classes used (here, V , HT, and E indicate Vector, Hashtable, and Enumeration, re- spectively), (v) the number of declarations of variables, pa- rameters, and fields that refer to legacy classes, (vi) the number of allocation sites referring to legacy classes, and (vii) the number of call sites referring to methods in legacy classes.... ..."

"... In PAGE 7: ...2 as an ARMulator simulating ARM922T processor. At first, we measure the code size overhead of the OS wrapper implementation as shown in Table1 . On the Linux platform, we measured the binary image size of the OS wrapper implementation and that of the total application.... ..."

"... In PAGE 4: ... Table2 shows the basic functions of OS kernel. Func- tion ContextSwitch performs context switching between the currently running task and the next task to be executed.... ..."