G. Paun, G. Rozenberg, and A. Salomaa, DNA Computing---New Computing Paradigms. New York: Springer-Verlag, 1998, pt. 1.  Home/Search   Document Not in Database   Summary   Related Articles   Check

....but perhaps in flowing capillary systems as exemplified by the PCR system of [KMM98] The proposals made here arose in the current of DNA computing studies generated by the electrifying work of L. Adleman [A94] Excellent introductory papers on DNA computing are [A98] Ka97] Am99] The book [PRS98] is highly recommended. The collection of papers [P98] will be of interest in any extensive study of biomolecular computing. Researchers have found the paper [L95] by R.Lipton to be highly stimulating and provocative. The note by J.Hartmanis [Ha95] sounds an important warning. The laboratory work ....

....an important warning. The laboratory work that is reported here was stimulated by [OKLL97] with the details stemming from [H87] HPP97] Ideas presented appear in [H98] in a more relaxed form, but with less generality and unification. For help with the biochemistry see the first chapter of [PRS98], the initial sections of [Ka97] or [HPP97] See [M95] as a thorough backup. 2 A Single Descriptive Format for Several Classical NP Complete Problems Many NP complete algorithmic problem families are readily assimilated to a common pattern which allows a solution by a single aqueous algorithm. ....

Gh.Paun, G.Rozenberg & A.Salomaa, "DNA Computing. New Computing Paradigms," Springer Verlag, (1998). XbaI BamHI Hind3 pBS DNA GTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGG

....splicing systems have been studied in [5] The original theoretical model of splicing systems had a computational power smaller than that of a finite state automaton. This has motivated several new models based on these original ideas, aiming at obtaining more powerful computing molecular devices ([4]) One direction has been that of putting together at work many test tubes, instead of only one. In each tube molecules are free to perform splicing, but some specified molecules can be moved from a tube to another. Several scientific papers already studied this model, looking for computationally ....

Gh. Paun, G. Rozenberg, A. Salomaa, DNA Computing: New Computing Paradigms, Springer Verlag, 1998.

.... growth functions TUCS Research Group Theory Group: Mathematical Structures in Computer Science 1 Introduction The idea of Watson Crick complementarity is central in Adleman s initial experiment, 1] The idea is also behind the computational universality of many models of DNA computing, [13, 9]. DNA (deoxyribonucleic acid) consists of polymer chains, referred to as DNA strands. A chain is composed of nucleotides or bases. The four DNA bases are customarily denoted by A (adenine) C (cytosine) G (guanine) and T (thymine) A DNA strand can be viewed as a word over the DNA alphabet ....

Paun, G., Rozenberg, G. and Salomaa, A. DNA Computing -- New Computing Paradigms. Springer-Verlag, Berlin, Heidelberg, New York, 1998.

.... sequences, DNA computing, growth functions, decidability TUCS Research Group Theory Group: Mathematical Structures in Computer Science 1 Introduction The interest in DNA computing has been growing rapidly since Adleman s famous contribution, 1] as apparent from the list of references in [12]. The impact of the resulting new notions and ideas to the theory of formal languages can be seen also from the recent Handbook, 14] A keynote in theoretical studies about DNA computing is a phenomenon known as Watson Crick complementarity. DNA (deoxyribonucleic acid) consists of polymer ....

....the phenomenon of complementarity provides computing power. The idea of using the fundamental knowledge, concerning how the double strands have possibly come into being, is central in Adleman s experiment, 1] The idea is also behind the computational universality of many models of DNA computing, [17, 12]. Complementarity can be viewed also as a language theoretic operation. As such hW is only a morphism of a special kind. However, the operational complementarity can be considered also as a tool in a developmental model: undesirable conditions in a string trigger a transition to the complementary ....

Paun, G., Rozenberg, G. and Salomaa, A. DNA Computing -- New Computing Paradigms. Springer-Verlag, Berlin, Heidelberg, New York, 1998.

....Science 1 Introduction Adleman s celebrated experiment, 1] demonstrated how methods of molecular biology can possibly be applied to problems intractable by ordinary computational methods. Since then the interest in DNA computing has been growing rapidly, see the list of references in [6]. The impact of the resulting new notions and ideas to the theory of formal languages is visible from the recent Handbook, 8] A keynote in theoretical studies about DNA computing is a phenomenon known as Watson Crick complementarity. DNA (deoxyribonucleic acid) consists of polymer chains, ....

....of complementarity provides computing power. The idea of using the fundamental knowledge, concerning how the double strands have possibly come into being, is central in Adleman s experiment, 1] The idea is also behind the computational universality of many models of DNA computing, 9] [6]. Complementarity can be viewed also as a language theoretic operation. As such hW is only a morphism of a special kind. However, the operational complementarity can be considered also as a tool in a developmental model: undesirable conditions in a string trigger a transition to the complementary ....

[Article contains additional citation context not shown here]

Paun, G., Rozenberg, G. and Salomaa, A. DNA Computing -- New Computing Paradigms. Springer-Verlag, Berlin, Heidelberg, New York, 1998.

....such an ultimate goal still remains elusive and there are still considerable obstructions to creating a practical molecular computer, nevertheless a tremendous amount of work has already been done concerning the theoretical foundations of DNA computing. Overall information can be obtained from [7] and the web site http: www.wi.LeidenUniv.nl jdassen dna.bib . The reader may consult also [3] 5] 8] 9] 11] 12] 15] While the requirement about universal computations posed in the above quotation has not yet been fulfilled, many theoretical models of DNA computing have been ....

....two strands in a double strand have always opposite orientations. Double strands can again be dissolved into single strands by heating the solution. This process is usually referred to as melting. The reverse process, referred to as annealing, is performed by cooling the solution. We refer to [7] for a survey about the operations possible or feasible with DNA strands. Studies of DNA computing have brought forward many significant new problem areas along these lines. The following observation is important. Watson Crick complementarity gives us some fundamental information for free : ....

[Article contains additional citation context not shown here]

Paun, G., Rozenberg, G. and Salomaa, A. DNA Computing -- New Computing Paradigms, in preparation.

No context found.

G. Paun, G. Rozenberg, and A. Salomaa, DNA Computing---New Computing Paradigms. New York: Springer-Verlag, 1998, pt. 1.

No context found.

Gh.Paun., G.Rozenberg and A.Salomaa. DNA Computing : New Computing Paradigms, Springer-Verlag, 1998.

No context found.

Gh.Paun., G.Rozenberg and A.Salomaa. DNA Computing : New Computing Paradigms, Springer-Verlag, 1998.

No context found.

Gh.Paun., G.Rozenberg and A.Salomaa. DNA Computing : New Computing Paradigms, Springer-Verlag, 1998.

Online articles have much greater impact   More about CiteSeer.IST   Add search form to your site   Submit documents   Feedback  

CiteSeer.IST - Copyright Penn State and NEC